A practical reference on Reversed-phase HPLC: what it is, how it behaves, what the literature reports, and where the honest uncertainties sit.
Reviewed 2026-07-14. Anything still debated is marked as such rather than presented as settled.
Published work on this compound consists mainly of in vitro experiments, animal studies, and small clinical investigations, a substantial share of which appeared in Russian-language journals. Sample sizes are generally small, control conditions differ between studies, and several endpoints rely on markers whose clinical meaning is itself debated. Reviews of the longevity field treat the peptide as an early example of telomerase-directed research rather than an established intervention. Regulatory treatment varies by country: some jurisdictions place it under prescription controls, others treat it as a laboratory material, and importation may be restricted regardless of local status.
Epitalon is a synthetic tetrapeptide whose sequence is alanine–glutamate–aspartate–glycine, commonly abbreviated AEDG. It was developed in Russia during the 1980s and 1990s by investigators associated with the St. Petersburg Institute of Bioregulation and Gerontology, who studied short peptides as regulators of gene expression and tissue function. The alternative spelling epithalon appears interchangeably in the literature, and the two names refer to the same molecule. Outside Russia it is encountered chiefly as a research chemical rather than a licensed medicine, and it holds no approval from the United States Food and Drug Administration or the European Medicines Agency.
The peptide is a synthetic analogue of epithalamin, a preparation extracted from bovine pineal glands. Investigators sought a short, chemically defined molecule that would reproduce some of the endocrine and gerontological observations attributed to the glandular extract. Proposed mechanisms centre on induction of telomerase activity, an effect reported in cultured human somatic cells in the early 2000s, together with influences on melatonin secretion and neuroendocrine regulation. Those mechanisms remain incompletely characterised, and the reported telomerase response has not been consistently reproduced by independent groups working in comparable systems.
Identity and purity are established with reversed-phase high-performance liquid chromatography and mass spectrometry. The chromatogram shows the main peak and any truncated or oxidised by-products, while the mass spectrum confirms the expected 390 dalton mass. Amino acid analysis can corroborate composition when a sample's origin is uncertain. Counterion content, particularly residual trifluoroacetate from purification, is frequently reported alongside purity because it shifts the net mass of the solid.
Reference material is normally supplied as a lyophilised powder in a sealed vial. Product literature typically recommends storage at minus twenty degrees Celsius or colder, protected from light and moisture. Freeze-thaw cycling is usually avoided because repeated condensation can introduce water into the vial. Working solutions are commonly prepared fresh, aliquoted, and kept cold for short periods rather than stored at ambient temperature. Labelling the date of opening helps track how long a vial has been in use.
Solubility is high in water, phosphate-buffered saline and normal saline, a pattern that follows from the two acidic residues in the chain. The peptide dissolves poorly in non-polar solvents such as hexane or chloroform. Stock solutions are often prepared in water first and then diluted into the buffer of interest. Because the molecule is small and hydrophilic, filtration through a low-protein-binding membrane is usually straightforward, and visible particulates are uncommon in freshly made solutions.
| Property | Value | Notes |
|---|---|---|
| Peptide sequence | Ala-Glu-Asp-Gly | Often abbreviated AEDG in research literature |
| Common synonyms | Epithalon, epitalon, AEDG | Spelling variants refer to the same tetrapeptide |
| Molecular formula | C14H22N4O9 | Theoretical monoisotopic mass near 390.35 Da |
| Appearance | White to off-white powder | Typically supplied as a lyophilised solid |
| Solubility class | Freely soluble in water | Hydrophilic peptide; dissolves in aqueous buffer |
Proposed mechanisms centre on cell-culture observations rather than a defined receptor interaction. Several reports describe increased expression of the telomerase catalytic subunit after exposure of cultured human cells, and the authors attributed the effect to short peptide fragments entering the nucleus and influencing gene transcription. No receptor for the tetrapeptide has been identified, and the free peptide is expected to be degraded rapidly by plasma peptidases. Whether any measurable fraction reaches intact tissues after administration remains an unresolved question rather than an established finding.
The published literature is dominated by a small number of research groups, much of it in Russian-language journals, and independent replication outside those groups is limited. Studies are typically small, use cultured cells or rodent models, and report endpoints that differ between papers, which makes comparison difficult. Large randomised human trials have not appeared in the indexed literature. Questions about absorption, distribution and clearance are therefore still treated as open in reviews that mention the compound.
Epitalon is a synthetic tetrapeptide with the sequence alanine–glutamate–aspartate–glycine, commonly abbreviated AEDG. Its design traces to epithalamin, a peptide fraction prepared from bovine pineal gland extracts that researchers in Saint Petersburg began investigating in the 1970s. The compound has a molecular formula of C14H22N4O9 and a nominal molecular mass near 390 daltons. It holds no approved drug status in the United States or the European Union, and material sold under this name is generally offered as a research chemical rather than a finished pharmaceutical product.
Regulatory treatment differs by country. No formulation of epitalon holds a marketing authorisation as a medicine in the United States or the European Union, where material sold for laboratory use is handled as a research chemical and is not intended for human consumption. In Russia, several short peptide preparations from the same institute's peptide series are registered medicinal products, and epitalon appears in that national context. Elsewhere it is frequently offered as a cosmetic ingredient, a category with lighter requirements. Advertising claims about longevity or disease prevention are restricted in most jurisdictions, which limits how sellers describe the compound.
Freeze-dried epitalon is normally kept at minus twenty degrees Celsius in a sealed, desiccated container, protected from light. Short excursions at ambient temperature during shipping are generally tolerated, but repeated warming and cooling cycles encourage moisture uptake, which shortens shelf life. Once dissolved, the peptide is far less stable than the solid: aqueous solutions are subject to hydrolysis and to deamidation at the aspartate and glutamate residues. Working solutions are therefore held refrigerated and used within days, and repeated freezing and thawing of the same vial is best avoided.
（TG:@pojiaai）Epitalon is a synthetic linear tetrapeptide with the sequence alanine-glutamate-aspartate-glycine, abbreviated AEDG. It emerged from work on epithalamin, a peptide fraction prepared from bovine pineal tissue, and was designed as a short, chemically defined analogue of that extract. Early publications came mainly from Russian laboratories studying pineal peptides and aging-related endpoints. The compound appears in the literature under several spellings, including epithalon and epithalone, which complicates systematic searching. Its small size makes solid-phase assembly and routine analytical characterization straightforward.
Chemically, the molecule consists of four amino acid residues joined by three peptide bonds, with a free N-terminal amino group and a free C-terminal carboxyl group. Its molecular formula is C14H22N4O9, and its monoisotopic mass is approximately 390 daltons. The acidic glutamate and aspartate side chains give the peptide a net negative charge near neutral pH, a property that shapes its chromatographic behaviour and solubility profile. No disulfide bridges or other post-translational modifications are present, so the primary sequence alone defines the structure.
Lyophilised epitalon is generally held at minus twenty degrees Celsius in a sealed container kept dry and dark. Cooler conditions are sometimes recommended for long-term archives. The solid takes up moisture readily enough that repeated opening of a vial introduces water, so dividing a batch into smaller portions before storage lowers degradation risk. Aqueous solutions are less durable than the dry powder and are usually prepared shortly before use, then kept cold and shielded from light to slow hydrolysis and oxidation.
Verification of research-grade material involves comparing a supplier chromatogram against an in-house reference, checking the observed mass against the calculated value, and where possible confirming residue order by tandem mass spectrometry or enzymatic peptide mapping. Purity claims should be read alongside the method used to obtain them, because detection wavelength and integration settings alter the result. Batch-specific data, rather than a generic grade statement, is the informative part of a certificate.
Identity and purity of epitalon samples are normally established by reversed-phase high-performance liquid chromatography with ultraviolet detection near 214 nanometres, combined with mass spectrometry. The mass spectrum confirms the expected molecular ion and can reveal truncated or oxidised by-products. Amino acid analysis after acid hydrolysis verifies that the four residues are present in the expected ratio. Certificates typically report a purity figure taken from chromatographic peak area, expressed as a percentage of total integrated signal.
The latter had expelled the Umayyads from the Hejaz and among the exiles to Syria was Marwan ibn al-Hakam, an Umayyad elder. Ubayd Allah persuaded Marwan, who was preparing to recognize Ibn al-Zubayr's sovereignty, to enter his candidacy as Mu'awiya II's successor. The Umayyads' principal Syrian allies, the Banu Kalb, had sought to maintain Umayyad rule and nominated Mu'awiya II's half-brother Khalid as caliph. However, the other pro-Umayyad Syrian tribes viewed Khalid as too young and inexperienced, and rallied around Marwan, who was ultimately chosen as caliph.
==== Steatosis ==== Hepatotoxicity may manifest as triglyceride accumulation, which leads to either small-droplet (microvesicular) or large-droplet (macrovesicular) fatty liver. There is a separate type of steatosis by which phospholipid accumulation leads to a pattern similar to the diseases with inherited phospholipid metabolism defects (e.g., Tay–Sachs disease)
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
=== Economic policy === In August 2026, Talarico announced a "New American Dream" economic policy agenda. The plan includes repealing tax cuts for the top 1% of earners; closing "billionaire tax loopholes"; providing universal childcare and paid family leave; providing down payment assistance for first-time homebuyers; cutting regulations on home building; providing grants to small businesses; an education investment resembling the G.I. Bill; and capping credit card interest rates. He has criticized trickle-down economics as a "false gospel" and has blamed affordability issues on corruption.
=== Conserved gene neighborhood === The conserved neighborhood method is based on the hypothesis that if genes encoding two proteins are neighbors on a chromosome in many genomes, then they are likely functionally related. The method is based on an observation by Bork et al. of gene pair conservation across nine bacterial and archaeal genomes. The method is most effective in prokaryotes with operons as the organization of genes in an operon is generally related to function. For instance, the trpA and trpB genes in Escherichia coli encode the two subunits of the tryptophan synthase enzyme known to interact to catalyze a single reaction. The adjacency of these two genes was shown to be conserved across nine different bacterial and archaeal genomes.
Sources: en.wikipedia.org
== Operations == Dutch Bros is headquartered in Tempe, Arizona. It had been based in Grants Pass, Oregon, since its 1992 founding, but began moving some corporate offices to Arizona in early 2024 and in June 2025 announced that it was relocating its headquarters there. The company is majority-owned by Travis Boersma, who holds the title of executive chairman, and Christine Barone is its president and CEO. In September 2021, Dutch Bros became a publicly traded company, selling 21 million shares for a total of $484 million. As of December 2023, the company employed approximately 24,000 people, and as of August 2024, it had 912 stores. In 2024, Dutch Bros opened a distribution and roasting center in Melissa, Texas. The center is a 65,000-square-foot plant located at the intersection of U.S. 75 and State Highway 121. In January 2026, it was announced that Dutch Bros had agreed to acquire Clutch Coffee Bar, a regional drive-through coffee chain with 20 locations across North and South Carolina. The financial terms were not disclosed, and Dutch Bros stated that the acquired locations would be closed, renovated, and reopened under its own brand. On August 5, 2026, the company announced it would be acquiring 65 locations from the chain Salad and Go (which permanently closed all its locations the same day) across Arizona, Nevada, Oklahoma and Texas.
==== Racemate separation ==== Since only one of the stereoisomers has the desired effect, the separation of a racemic mixture of hydroxy N- methyl morphinan using tartaric acid and subsequent methylation of the hydroxyl group is a suitable method. By using (D)-tartrate, the (+)-isomer remains as the product.
East Germany closed itself to the sporting world in May 1965. In 1977 the shot-putter Ilona Slupianek, who weighed 93 kg, failed a test for anabolic steroids at the European Cup meeting in Helsinki and thereafter athletes were tested before they left the country. At the same time, the Kreischa testing laboratory near Dresden passed into government control; it reputedly made around 12,000 tests a year on East German athletes but without any being penalised. The International Amateur Athletics Federation (IAAF) suspended Slupianek for 12 months, a penalty that ended two days before the European championships in Prague. In the reverse of what the IAAF hoped, sending her home to East Germany meant she was free to train unchecked with anabolic steroids, if she wanted to, and then compete for another gold medal, which she won. After that, almost nothing emerged from the East German sports schools and laboratories. A rare exception was the visit by the sports-writer and former athlete, Doug Gilbert of the Edmonton Sun, who said:
On Truth Social, Trump expressed his anger that the press pool had "refused to cover one of the Biggest and Most Beautiful Events to take place in many years". The press pool resumed its coverage of Trump on September 25 after the administration reinstated the news outlets.
Sources: en.wikipedia.org
A further way of carrying out glycosylation is by using enzymes, known as chemo-enzymatic glycosylation. This method is used for complex chemical synthesis. Chemical and chemo-enzymatic methods can be used for the synthesis of glycopeptides and glycoproteins. Cyclization can also be used as a method to decrease proteolytic degradation and prolong half-life, to make the peptide conformation more rigid to hinder enzymatic cleavage. This method can however lead to loss of biological function due to the reduced flexibility making the peptide inactive. For example, side chain to side chain cyclization between asparagine (position 8) and lysine (position 12), of a growth regulating factor (GRF) analogue was found to increase the half-life from 17 minutes to more than 2 hours. Another way to extend half-life do is to bind serum albumin to the peptide. Human serum albumin is the most abundant plasma protein with a molecular weight of 66.4 kDa, and it is involved in many essential bodily functions to maintain homoeostasis. As a result, albumin binding would significantly increase the molecular weight of the peptide, restricting it from being filtered into the urine by the GBM. Serum albumin has an extraordinary long half-life of 2–4 weeks which is much longer than other plasma proteins, due to it binding to the neonatal Fc receptor (FcRn). Fc receptors are proteins found on the surface of certain cells that help to protect the functions of the immune system, by binding to the Fc region of antibodies, which attach to pathogens and destroy them.
=== Diet === Changes in diet may help prevent the development of atherosclerosis. Tentative evidence suggests that a diet containing dairy products has no effect on or decreases the risk of cardiovascular disease. A diet rich in fruits and vegetables lowers the risk of cardiovascular disease and death. Evidence suggests that the Mediterranean diet may improve cardiovascular results. There is also evidence that a Mediterranean diet may be better than a low-fat diet in bringing about long-term changes to cardiovascular risk factors (e.g., lower cholesterol level and blood pressure). A 2024 review highlighted that bioactive compounds found in Mediterranean diet components (such as olive, grape, garlic, rosemary, and saffron) exhibit properties that may contribute to cardiovascular health and atherosclerosis prevention.
== Osteocyte feedback == Feedback from physical activity maintains bone mass, while feedback from osteocytes limits the size of the bone-forming unit. An important additional mechanism is secretion by osteocytes, buried in the matrix, of sclerostin, a protein that inhibits a pathway that maintains osteoblast activity. Thus, when the osteon reaches a limiting size, it deactivates bone synthesis.
For research purposes, curium is obtained by irradiating not uranium but plutonium, which is available in large amounts from spent nuclear fuel. A much higher neutron flux is used for the irradiation that results in a different reaction chain and formation of 244Cm:
=== Other industry-specific tasks === In a 2017 survey, one in five companies reported having incorporated "AI" in some offerings or processes. In the field of evacuation and disaster management, AI has been used to investigate patterns in large-scale and small-scale evacuations using historical data from GPS, videos or social media. During the 2024 Indian elections, US$50 million was spent on authorised AI-generated content, notably by creating deepfakes of allied (including sometimes deceased) politicians to better engage with voters, and by translating speeches to various local languages. The use of generative AI by law firms for legal research resulted in the creation of the global "AI Hallucination Cases" database, in April 2025, established by HEC Paris and Sciences Po legal data analysis lecturer Damien Charlotin. By 2026, judges had issued sanctions and bar associations had issued warnings due to attorney submissions to the courts containing fabricated case law citations hallucinated by AI tools.
Sources: en.wikipedia.org
Epitalon is a synthetic four-amino-acid peptide with the sequence alanine–glutamate–aspartate–glycine, also written AEDG. It was developed in Russian gerontology research and is studied for proposed effects on telomerase, melatonin regulation, and neuroendocrine function. It is not an approved pharmaceutical in the United States or the European Union.
No. Epithalamin is a peptide-rich extract prepared from bovine pineal glands, while epitalon is a short synthetic peptide designed as a defined analogue of it. The synthetic version was intended to provide a reproducible molecule with some of the same proposed biological activity.
Telomere elongation and telomerase activation have been reported in cultured human somatic cells, but evidence from living human subjects is limited and has not been independently confirmed at scale. Reported findings come largely from small studies with differing designs, so the question remains open rather than settled.
Sealed lyophilised powder is normally kept at minus twenty degrees Celsius or below, away from light and moisture. Vials are allowed to reach room temperature before opening to limit condensation. Repeated warming and cooling of the same vial is discouraged.